Creationists

[ima]

Anyone who believes in a myth and their relatives were chimps and that wants to destroy the culture of America go vote for obama.

One of these days I hope you wise up.

Seriously though, anyone who writes that Noah was 600 years old can't count.

How do you know ?

Humans didn't live that long back then. They still don't.

 

[Youwerecreated]

Anyone who claims that the world was made in 6 days by an invisible superbeing is obviously a moron. Now go vote for Mitt Romney.

Anyone who believes in a myth and their relatives were chimps and that wants to destroy the culture of America go vote for obama.

One of these days I hope you wise up.

I can scarsely think of a worse fate for the US than to be dragged back into the Dark Ages of fear and superstition furthered by Christian fundamentalists.

Romney a Christian fundamentalist One man does not make law.

 

[Youwerecreated]

So with all those animals on his boat, how much shit did Noah have to shovel during those 40 days and nights? I bet he had to make sure not to shovel it all to one side of the boat though.

Don't know,what's your point ?

 

[Youwerecreated]

Your error in refusing to acknowledge the distinction in the the way geneticists use the term code cannot be resolved by insisting upon applying your error of equivocation in the use of the term "code."

Loki do you understand DNA transcription ? why does this take place ?

No, he just doesn't get it. Lack of a formal education has left him to attempt understanding by what he reads on the internet without external guidance to put it into context.

He is somewhat on the right track but I am trying to let make his own case for purposeful design.

 

[Youwerecreated]

If Noah had lions and tigers, which eat meat, did he have extra chickens and goats and stuff? Or did god give him a magic bowl of dog food that never ran dry?

According to the scriptures all organisms were vegetarians except humans,that did not change until after the boat ride.

 

[ima]

So with all those animals on his boat, how much shit did Noah have to shovel during those 40 days and nights? I bet he had to make sure not to shovel it all to one side of the boat though.

Don't know,what's your point ?

Point being, Noah sounds like he shovelled a lot of shit. Must have been hard for a 600 year old. What do you think?

 

[Youwerecreated]

Loki do you understand DNA transcription ? why does this take place ?

No, he just doesn't get it. Lack of a formal education has left him to attempt understanding by what he reads on the internet without external guidance to put it into context.

I've had sufficient formal education to disabuse myself of the superstitious notion that the DNA in living things must be an informed molecule based upon the premise that DNA is a symbol for proteins whose information is independent of the chemistry of the DNA molecule.

Where did the code come from ? what happens if the instructions are not followed in most cases ?

 

[Youwerecreated]

If Adam and Eve had 3 sons, how did they have children? With monkeys? Goats? With their mom?

Enough is enough you had your chance to discuss things like an adult your time has come and is now gone.

 

[Youwerecreated]

So with all those animals on his boat, how much shit did Noah have to shovel during those 40 days and nights? I bet he had to make sure not to shovel it all to one side of the boat though.

Don't know,what's your point ?

Point being, Noah sounds like he shovelled a lot of shit. Must have been hard for a 600 year old. What do you think?

Yes,kinda like UR and I.

 

[LOki]

Loki do you understand DNA transcription ?

Yes. At least far better than UltimateReality does.

why does this take place ?

It happens because the sequences of nucleotides are not symbols for proteins--nucleotides CANNOT be substituted with other "symbols." The information contained in DNA is DEPENDENT upon the DNA molecule used to transfer the instructions--the information and instructions contained in DNA is INDISSOCIABLE from the chemistry of the DNA molecule. You CANNOT alter the chemistry of the molecule (systematically or otherwise) and expect the protein thus "coded" for.

Dependent, does that not suggest a necessity,do you believe chance produces a necessity ?

There is no answer to this nonsense question. Do you believe blue adds up to 27?

So what happens if a mutation happens ?

Nothing, IF DNA is a symbol for proteins whose information is independent of the chemistry of the DNA molecule, as the disingenuous retard you defend so enthusiastically demands.

OTOH if I am correct, and DNA is a NOT symbol for proteins, but a molecule whose information is dependent on... no, MORE than just dependent on... INHERENT in its chemistry; if, as I have clearly stated, you CANNOT alter the chemistry of the molecule (systematically or otherwise) and then expect no alteration of the initial protein coded for, then there will be a change expressed in the product (i.e. the protein in this case) of the altered information that constitutes the mutation.

 

[Hollie]

No, he just doesn't get it. Lack of a formal education has left him to attempt understanding by what he reads on the internet without external guidance to put it into context.

I've had sufficient formal education to disabuse myself of the superstitious notion that the DNA in living things must be an informed molecule based upon the premise that DNA is a symbol for proteins whose information is independent of the chemistry of the DNA molecule.

Where did the code come from ? what happens if the instructions are not followed in most cases ?

In the grown-up world, we use terms such as evolution and cell mutation?

Where did your gods come from? Define for us the hierarchy of gods who zapped into existence the subordinate gods who in turn zapped into existence the lower order of subordinate gods until we eventually got the lowest order of subordinate gods, ie., your gods.

What happens to your gods if they don't follow the orders of the gods they are junior to?

 

[Hollie]

Loki do you understand DNA transcription ? why does this take place ?

No, he just doesn't get it. Lack of a formal education has left him to attempt understanding by what he reads on the internet without external guidance to put it into context.

He is somewhat on the right track but I am trying to let make his own case for purposeful design.

Any case to be made for purposeful design is incumbent on those who assert a "designer".

To date, nothing has been submitted to suggest a designer of any sort. We have only seen failed attacks on science as alleged proof of a designer. This is a common tactic of the Christian anti-science ministries. No evidence of any "designer" gods is available so the creationist cabal attempts attacks on science to deflect criticism of their failings to offer positive evidence.

 

[Hollie]

If Noah had lions and tigers, which eat meat, did he have extra chickens and goats and stuff? Or did god give him a magic bowl of dog food that never ran dry?

According to the scriptures all organisms were vegetarians except humans,that did not change until after the boat ride.

In the grown-up world of education and knowledge, we know that there are animals we rationally define as "carnivores". You can look for the definition of this term and take the first step toward being a grown-up.

So.... after Noah's cruise (the "cruise to nowhere"), which the serial mass murderer gods acted as travel agents for so they could wipe humanity from the planet, what did the carnivorous animals eat?

 

[LOki]

No, he just doesn't get it. Lack of a formal education has left him to attempt understanding by what he reads on the internet without external guidance to put it into context.

I've had sufficient formal education to disabuse myself of the superstitious notion that the DNA in living things must be an informed molecule based upon the premise that DNA is a symbol for proteins whose information is independent of the chemistry of the DNA molecule.

Where did the code come from ?

If by "code" you mean;

• "A system of words, letters, figures, or other symbols used to represent others, esp. for the purposes of secrecy";
• "a system for communication by telegraph, heliograph, etc., in which long and short sounds, light flashes, etc., are used to symbolize the content of a message";
• "a system used for brevity or secrecy of communication, in which arbitrarily chosen words, letters, or symbols are assigned definite meanings."
• "A system of signals used to represent letters or numbers in transmitting messages."
• "A system of symbols, letters, or words given certain arbitrary meanings, used for transmitting messages requiring secrecy or brevity."
• "A system of symbols and rules used to represent instructions to a computer;"
• "a system of letters or symbols, and rules for their association by means of which information can be represented or communicated for reasons of secrecy, brevity, etc.;"
• "a system of letters or digits used for identification or selection purposes;"
• "a system of words, letters, figures, or symbols used to represent others, especially for the purposes of secrecy;"
• "a phrase or concept used to represent another in an indirect way;"
• "a series of letters, numbers, or symbols assigned to something for the purposes of classification or identification;"
• "Computing program instructions;"

then I have no idea what you're talking about, because DNA isn't a symbol for proteins in living things; it is just the sequence of nucleotides in DNA or RNA that determines the specific amino acid sequence in the synthesis of proteins.

what happens if the instructions are not followed in most cases ?

If by "instructions" you mean;

• "a direction calling for compliance;"
• "an outline or manual of technical procedure;"
• "a code that tells a computer to perform a particular operation;"
• "the act of furnishing with authoritative directions;"
• "orders or directions;"
• "commands given to a computer to carry out a particular operation;"
• "the process or act of imparting knowledge;"
• "a part of a program consisting of a coded command to the computer to perform a specified function;"

then I have no idea what you're talking about, because DNA is just a molecule whose effect on the ordinary reactions of protein synthesis promotes specific amino acid sequences in proteins.

I am certain that if there was less room for equivocating in your usage of the terms, I could give you better answers. But then the answers then given wouldn't be consistent with your faith, or subject to typical and predictable red-herring refutations.

 

[UltimateReality]

Yes. At least far better than UltimateReality does.

It happens because the sequences of nucleotides are not symbols for proteins--nucleotides CANNOT be substituted with other "symbols." The information contained in DNA is DEPENDENT upon the DNA molecule used to transfer the instructions--the information and instructions contained in DNA is INDISSOCIABLE from the chemistry of the DNA molecule. You CANNOT alter the chemistry of the molecule (systematically or otherwise) and expect the protein thus "coded" for.

Strawman and repetitive irrelevant point. Bravo, Short Bus!!! Again, no one is claiming this. What I did claim was that the DNA molecule contains information that is independent from the molecule itself.

Let's just review the record:

What you can't get is that dna as a molecule is chemically independent from the informational code it carries!!

Where's the stawman now?

This has been proven as the molecule has been used a storage medium for information other than used for protein building. But hey, please don't let me stop you from making your totally irrelevant point to the argument a 10th time, M&M.

NOBODY is disputing that DNA CAN be used to code in the manner you use the term.

And when you percieve an opportunity to declare my rebuttal to your position a strawman, NOBODY disputes my point that sequences of nucleotides are not symbols for proteins--nucleotides CANNOT be substituted with other "symbols." The information contained in DNA is DEPENDENT upon the DNA molecule used to transfer the instructions--the information and instructions contained in DNA is INDISSOCIABLE from the chemistry of the DNA molecule. You CANNOT alter the chemistry of the molecule (systematically or otherwise) and expect the protein thus "coded" for.

Strawman assertion #17. This is not the claim but your typical semantics twist of what is being claimed. For the 10th time, I'm not saying the nucleotides can be substituted. What I am saying the information dna carries is independent of the mere chemistry of the molecule. Unless the information in DNA is specific, it cannot be used to assemble the multitude of proteins that exist in the cell. The DNA molecule bears the information required to assemble proteins, but this information is not a result of the chemistry, it is a result of the specific information contained in the code. There is overwhelming evidence it didn't get there randomly, but the required informational sequences were programmed in. How many times can I say the same thing and you still assert I am saying something different. Guess we will find out when you say the same thing again, Snickers.

 

[UltimateReality]

Yes. At least far better than UltimateReality does.

It happens because the sequences of nucleotides are not symbols for proteins--nucleotides CANNOT be substituted with other "symbols." The information contained in DNA is DEPENDENT upon the DNA molecule used to transfer the instructions--the information and instructions contained in DNA is INDISSOCIABLE from the chemistry of the DNA molecule. You CANNOT alter the chemistry of the molecule (systematically or otherwise) and expect the protein thus "coded" for.

Dependent, does that not suggest a necessity,do you believe chance produces a necessity ?

There is no answer to this nonsense question. Do you believe blue adds up to 27?

So what happens if a mutation happens ?

Nothing, IF DNA is a symbol for proteins whose information is independent of the chemistry of the DNA molecule, as the disingenuous retard you defend so enthusiastically demands.

You're a disingenuous liar. I did not say DNA was a symbol for proteins. I said the nucleotides otherwise know as G, T, C, A code for proteins just like 0's and 1's code for symbols like A, B, C, and D. Basically, the nucleotides are the code and the protein is the symbol. It was you that applied your vividimagination to this statement, ineptly couldn't see the comparison as usual, and went off for pages about what I fool I am when it was really your ignorance that led you down that path.

Loki's ignorance of Loki's ignorance is the malady of the Loki.

The binary sequence 10010011001110100010110100001010100 when decoded by a machine produces the string of symbols: INEPT

The dna sequence AGTAAAGGAGAAGAACTTTTCACTGGAGTC, when decoded by a molecular machine, stands for the amino acids in specific order Ser-Lys-Gly-Glu-Glu-Leu-Phe-Thr-Gly-Val- which can be represented by SKGEELFTGV which, in turn, is part of the full specifically ordered code required to assemble the polyprotein represented by the following sequence:

MGSVSKGEELFTGVVPILVELDGDVNGHKFSVSGEGEGDATYGKLTLKFICTTGKLPVPWPTLVTTLTYGVQCFSRYPDHMKQHDFFKSAMPEGYVQERTIFFKDDGNYKTRAEVKFEGDTLVNRIELKGIDFKEDGNILGHKLEYNYNSHNVYIMADKQKNGIKVNFKIRHNIEDGSVQLADHYQQNTPIGDGPVLLPDNHYLSTQSALSKDPNEKRDHMVLLEFVTAAGITLGMDELYKAITTLGSQVSTQRSGSHENSNSATEGSTINYTTINYYKDSYAATAGKQSLKQDPDKFANPVKDIFTEMAAPLKSPSAEACGYSDRVAQLTIGNSTITTQEAANIIVGYGEWPSYCSDDDATAVDKPTRPDVSVNRFYTLDTKLWEKSSKGWYWKFPDVLTETGVFGQNAQFHYLYRSGFCIHVQCNASKFHQGALLVAILPEYVIGTVAGGTGTEDSHPPYKQTQPGADGFELQHPYVLDAGIPISQLTVCPHQWINLRTNNCATIIVPYMNTLPFDSALNHCNFGLLVVPISPLDFDQGATPVIPITITLAPMCSEFAGLRQAVTQGFPTEPKPGTNQFLTTDDGVSAPILPNFHPTPCIHIPGEVRNLLELCQVETILEVNNVPTNATSLMERLRFPVSAQAGKGELCAVFRADPGRDGPWQSTMLGQLCGYYTQWSGSLEVTFMFTGSFMATGKMLIAYTPPGGPLPKDRATAMLGTHVIWDFGLQSSVTLVIPWISNTHYRAHARDGVFDYYTTGLVSIWYQTNYVVPIGAPNTAYIIALAAAQKNFTMKLCKDTSHILQTASIQGDRVADVIESSIGDSVSRALTQALPAPTGQNTQVSSHRLDTGEVPALQAAEIGASSNTSDESMIETRCVLNSHSTAETTLDSFFSRAGLVGEIDLPLEGTTNPNGYANWDIDITGYAQMRRKVELFTYMRFDAEFTFVACTPTGGVVPQLLQYMFVPPGAPKPESRESLAWQTATNPSVFVKLTDPPAQVSVPFMSPASAYQWFYDGYPTFGEHKQEKDLEYGACPNNMMGTFSVRTVGSLKSKYPLVVRIYMRMKHVRAWIPRPMRNQNYLFKANPNYAGNSIKPTGTSRTAITTLGKFGQQSGAIYVGNFRVVNRHLATHNDWANLVWEDSSRDLLVSSTTAQGCDTIARCDCQTGVYYCNSKRKHYPVSFSKPSLIYVEASEYYPARYQSHLMLAAGHSEPGDCGGILRCQHGVVGIVSTGGNGLVGFADVRDLLWLDEEAMEQGVSDYIKGLGDAFGTGFTDAVSREVEALKNHLIGSEGAVEKILKNLIKLISALVIVIRSDYDMVTLTATLALIGCHGSPWAWIKAKTASILGIPIAQKQSASWLKKFNDMANAAKGLEWISSKISKFIDWLKEKIIPAAREKVEFLNNLKQLPLLENQISNLEQSAASQEDLEAMFGNVSYLAHFCRKFQPLYAAEAKRVYALEKRMNNYMQFKSKHRIEPVCLIIRGSPGTGKSLATGIIARAIADKYHSSVYSLPPDPDHFDGYKQQVVTVMDDLCQNPDGKDMSLFCQMVSTVDFIPPMASLEEKGVSFTSKFVIASTNSSNIIVPTVSDSDAIRRRFYMDCDIEVTDSYKTDLGRLDAGRAAKLCSENNTANFKRCSPLVCGKAIQLRDRKSKVRYSVDTVVSELIREYNNRSAIGNTIEALFQGPPKFRPIRISLEEKPAPDAISDLLASVDSEEVRQYCRDQGWIIPETPTNVERHLNRAVLVXQSIATVVAVVSLVYVIYKLFAGFQGAYSGAPKQILKKPVLRTATVQGPSLDFALSLLRRNIRQVQTDQGHFTMLGVRDRLAVLPRHSQPGKTIWVEHKLVNILDAVELVDEQGVNLELTLITLDTNEKFRDITKFIPESISAASDATLVINTEHMPSMFVPVGDVVQYGFLNLSGKPTHRTMMYNFPTKAGQCGGVVTSVGKVIGIHIGGNGRQGFCAGLKRSYFASEQGEIQWVKPNKETGRLNINGPTRTKLEPSVFHDVFEGNKEPAVLHSKDPRLEVDFEQALFSKYVGNTLYEPDEYIKEAALHYANQLKQLDIDTSQMSMEEACYGTENLEAIDLHTSAGYPYSALGIKKRDILDSTTRDVSKMKFYMDKYGLDLPYSTYVKDELRSIDKIKKGKSRLIEASSLNDSVYLRMTFGHLYETFHANPGTVTGSAVGCNPDTFWSKLPILLPGSLFAFDYSGYDASLSPVWFRALELVLREIGYSEEAVSLVEGINHTHHVYRNKTYCVLGGMPSGCSGTSIFNSMINNIIIRALLIKTFKGIDLDELNMVAYGDDVLASYPFPIDCLELARTGKEYGLTMTPADKSPCFNEVNWDNATFLKRGFLPDEQFPFLIHPTMPMKEIHESIRWTKDARNTQDHVRSLCLLAWHNGKQEYEKFVSAIRSVPVGKALAIPNYENLRRNWLELF

Loki would have you believe that these instructions, carried by the specific arrangement of nucleotides in the dna molecule randomly occurred and just happen to puke out a fully functional protein with all the correct bends to form its extremely complex structure. Not only that, but this protein interacts with 1000's of other proteins inside an organism to produce just one of many functions required for that orgainism's survival. Do you possibly have any grasp the odds against producing this protein much less producing this and the other proteins with as much or more complexity to work in concert together with each other inside a complex organism. Only a fool would believe that time was the "magic" that made this happen all by itself.

But just keep telling yourself it wasn't designed... it wasn't designed.

 

[UltimateReality]

I've had sufficient formal education to disabuse myself of the superstitious notion that the DNA in living things must be an informed molecule based upon the premise that DNA is a symbol for proteins whose information is independent of the chemistry of the DNA molecule.

Where did the code come from ?

If by "code" you mean;

• "A system of words, letters, figures, or other symbols used to represent others, esp. for the purposes of secrecy";
• "a system for communication by telegraph, heliograph, etc., in which long and short sounds, light flashes, etc., are used to symbolize the content of a message";
• "a system used for brevity or secrecy of communication, in which arbitrarily chosen words, letters, or symbols are assigned definite meanings."
• "A system of signals used to represent letters or numbers in transmitting messages."
• "A system of symbols, letters, or words given certain arbitrary meanings, used for transmitting messages requiring secrecy or brevity."
• "A system of symbols and rules used to represent instructions to a computer;"
• "a system of letters or symbols, and rules for their association by means of which information can be represented or communicated for reasons of secrecy, brevity, etc.;"
• "a system of letters or digits used for identification or selection purposes;" But of course, the digits identify the correct amino acid for the molecular machine provide information on which order they should be selected in.
• "a system of words, letters, figures, or symbols used to represent others, especially for the purposes of secrecy;"
• "a phrase or concept used to represent another in an indirect way;"
• "a series of letters, numbers, or symbols assigned to something for the purposes of classification or identification;" Yes, the specific arrangement of nucleotides identifies which amino acid will be selected for a particular machine.
• "Computing program instructions;"

then I have no idea what you're talking about, because DNA isn't a symbol for proteins [You are correct. But comparing dna to binary code in a computer, just like the letter 'A' is a symbol that can be transmitted by a particular order of 0's and 1's, so too can the instructions to build a protein be transmitted by G's, T's, C's, and A's.] so is the protein of symboin living things; it is just the sequence of nucleotides in DNA or RNA that determines the specific amino acid sequence in the synthesis of proteins.

what happens if the instructions are not followed in most cases ?

If by "instructions" you mean;

• "a direction calling for compliance;"
• "an outline or manual of technical procedure;"
• "a code that tells a computer to perform a particular operation;"
• "the act of furnishing with authoritative directions;"
• "orders or directions;"
• "commands given to a computer to carry out a particular operation;"
• "the process or act of imparting knowledge;"
• "a part of a program consisting of a coded command to the computer to perform a specified function;"

then I have no idea what you're talking about, because DNA is just a molecule whose effect on the ordinary reactions* of protein synthesis promotes specific amino acid sequences in proteins. *Assumptive language and pathetic attempt at subtle brainwashing. This is the type of stuff poor dear Hollie falls for.

I am certain that if there was less room for equivocating in your usage of the terms, I could give you better answers. But then the answers then given wouldn't be consistent with your faith, or subject to typical and predictable red-herring refutations.

Bingo Twix. All of the bolded above can be implied. DNA carries instructions, by way of quaternary code, that tell a molecular machine what specific ingredients it needs in what specific order to assemble a component for another molecular machine.

The "ordinary reactions" that Sweetart refers to above assemble complex proteins like this one:

"While the pretty pictures published on book covers and journals are indeed accurate, they only tell part of the story. These images don't represent every possible form of the molecule, or perhaps even the most biologically interesting ones. Rather these are the most stable or crystallizable states, what North Carolina State University physicist Keith Weninger calls “landmarks in a conformational landscape.”

And that's just in vitro; what a protein looks like in vivo may differ even more. “Living cells are amazing things,” Weninger says. “They maintain non-equilibrium conditions; the system keeps gradients that shouldn't exist, and very non-equilibrium flows, and those are hard to reproduce outside of a cell. Those conditions can affect biology, which is why people want to develop high-resolution methods to look at protein structure in cells.”

The Photosystem membrane protein complex, deduced using femtosecond X-ray protein nanocrystallography

 

[LOki]

Strawman and repetitive irrelevant point. Bravo, Short Bus!!! Again, no one is claiming this. What I did claim was that the DNA molecule contains information that is independent from the molecule itself.

Let's just review the record:Where's the stawman now?

This has been proven as the molecule has been used a storage medium for information other than used for protein building. But hey, please don't let me stop you from making your totally irrelevant point to the argument a 10th time, M&M.

NOBODY is disputing that DNA CAN be used to code in the manner you use the term.

And when you percieve an opportunity to declare my rebuttal to your position a strawman, NOBODY disputes my point that sequences of nucleotides are not symbols for proteins--nucleotides CANNOT be substituted with other "symbols." The information contained in DNA is DEPENDENT upon the DNA molecule used to transfer the instructions--the information and instructions contained in DNA is INDISSOCIABLE from the chemistry of the DNA molecule. You CANNOT alter the chemistry of the molecule (systematically or otherwise) and expect the protein thus "coded" for.

Strawman assertion #17. This is not the claim but your typical semantics twist of what is being claimed. For the 10th time, I'm not saying the nucleotides can be substituted.

You most certainly are.

What I am saying the information dna carries is independent of the mere chemistry of the molecule.

See? You indeed are saying that any systematic substitution of nucleotides will impart the same function; no need to use DNA at all to carry the information because, "the information dna carries is independent of the mere chemistry of the molecule."

Unless the information in DNA is specific, it cannot be used to assemble the multitude of proteins that exist in the cell.

The information in DNA is either so specific that it is not a symbol for proteins and is not independent of the chemistry of the molecule--OR--any systematic substitution of nucleotides (with other nucleotides or other chemical groups) will impart the same function because "the information dna carries is independent of the mere chemistry of the molecule."

The DNA molecule bears the information required to assemble proteins, but this information is not a result of the chemistry, it is a result of the specific information contained in the code.

Then you indeed are saying that any systematic substitution of nucleotides will impart the same function; no need to use DNA at all to carry the information because, "the information dna carries is independent of the mere chemistry of the molecule."

There is overwhelming evidence it didn't get there randomly, ...

Not in dispute. Everyone but you seems to understand that this is because the information DNA carries is inherent in the chemistry of the molecule.

... but the required informational sequences were programmed in. How many times can I say the same thing and you still assert I am saying something different. Guess we will find out when you say the same thing again, Snickers.

As predicted hundreds of posts ago, all you bring is some self-contradictory, question-begging, special-pleading appeal-to-ignorance account of some "God."

 

[LOki]

Dependent, does that not suggest a necessity,do you believe chance produces a necessity ?

There is no answer to this nonsense question. Do you believe blue adds up to 27?

So what happens if a mutation happens ?

Nothing, IF DNA is a symbol for proteins whose information is independent of the chemistry of the DNA molecule, as the disingenuous retard you defend so enthusiastically demands.

You're a disingenuous liar. I did not say DNA was a symbol for proteins.

Let's just review ... aw fuck it ... we all know how the internet works, and I have demonstrated you have said this.

I said the nucleotides otherwise know as G, T, C, A code for proteins just like 0's and 1's code for symbols like A, B, C, and D. Basically, the nucleotides are the code and the protein is the symbol. It was you that applied your vividimagination to this statement, ineptly couldn't see the comparison as usual, and went off for pages about what I fool I am when it was really your ignorance that led you down that path.

It is only in your mendacious imagination that you were not so exceedingly clear about, and insistent upon your assertions that there was no room for misinterpretation.

So DESPERATE in your cognitive dissonance are you, that you are brought to this:

Loki's ignorance of Loki's ignorance is the malady of the Loki.

The binary sequence 10010011001110100010110100001010100 when decoded by a machine produces the string of symbols: INEPT

The dna sequence AGTAAAGGAGAAGAACTTTTCACTGGAGTC, when decoded by a molecular machine, stands for the amino acids in specific order Ser-Lys-Gly-Glu-Glu-Leu-Phe-Thr-Gly-Val- which can be represented by SKGEELFTGV which, in turn, is part of the full specifically ordered code required to assemble the polyprotein represented by the following sequence:

MGSVSKGEELFTGVVPILVELDGDVNGHKFSVSGEGEGDATYGKLTLKFICTTGKLPVPWPTLVTTLTYGVQCFSRYPDHMKQHDFFKSAMPEGYVQERTIFFKDDGNYKTRAEVKFEGDTLVNRIELKGIDFKEDGNILGHKLEYNYNSHNVYIMADKQKNGIKVNFKIRHNIEDGSVQLADHYQQNTPIGDGPVLLPDNHYLSTQSALSKDPNEKRDHMVLLEFVTAAGITLGMDELYKAITTLGSQVSTQRSGSHENSNSATEGSTINYTTINYYKDSYAATAGKQSLKQDPDKFANPVKDIFTEMAAPLKSPSAEACGYSDRVAQLTIGNSTITTQEAANIIVGYGEWPSYCSDDDATAVDKPTRPDVSVNRFYTLDTKLWEKSSKGWYWKFPDVLTETGVFGQNAQFHYLYRSGFCIHVQCNASKFHQGALLVAILPEYVIGTVAGGTGTEDSHPPYKQTQPGADGFELQHPYVLDAGIPISQLTVCPHQWINLRTNNCATIIVPYMNTLPFDSALNHCNFGLLVVPISPLDFDQGATPVIPITITLAPMCSEFAGLRQAVTQGFPTEPKPGTNQFLTTDDGVSAPILPNFHPTPCIHIPGEVRNLLELCQVETILEVNNVPTNATSLMERLRFPVSAQAGKGELCAVFRADPGRDGPWQSTMLGQLCGYYTQWSGSLEVTFMFTGSFMATGKMLIAYTPPGGPLPKDRATAMLGTHVIWDFGLQSSVTLVIPWISNTHYRAHARDGVFDYYTTGLVSIWYQTNYVVPIGAPNTAYIIALAAAQKNFTMKLCKDTSHILQTASIQGDRVADVIESSIGDSVSRALTQALPAPTGQNTQVSSHRLDTGEVPALQAAEIGASSNTSDESMIETRCVLNSHSTAETTLDSFFSRAGLVGEIDLPLEGTTNPNGYANWDIDITGYAQMRRKVELFTYMRFDAEFTFVACTPTGGVVPQLLQYMFVPPGAPKPESRESLAWQTATNPSVFVKLTDPPAQVSVPFMSPASAYQWFYDGYPTFGEHKQEKDLEYGACPNNMMGTFSVRTVGSLKSKYPLVVRIYMRMKHVRAWIPRPMRNQNYLFKANPNYAGNSIKPTGTSRTAITTLGKFGQQSGAIYVGNFRVVNRHLATHNDWANLVWEDSSRDLLVSSTTAQGCDTIARCDCQTGVYYCNSKRKHYPVSFSKPSLIYVEASEYYPARYQSHLMLAAGHSEPGDCGGILRCQHGVVGIVSTGGNGLVGFADVRDLLWLDEEAMEQGVSDYIKGLGDAFGTGFTDAVSREVEALKNHLIGSEGAVEKILKNLIKLISALVIVIRSDYDMVTLTATLALIGCHGSPWAWIKAKTASILGIPIAQKQSASWLKKFNDMANAAKGLEWISSKISKFIDWLKEKIIPAAREKVEFLNNLKQLPLLENQISNLEQSAASQEDLEAMFGNVSYLAHFCRKFQPLYAAEAKRVYALEKRMNNYMQFKSKHRIEPVCLIIRGSPGTGKSLATGIIARAIADKYHSSVYSLPPDPDHFDGYKQQVVTVMDDLCQNPDGKDMSLFCQMVSTVDFIPPMASLEEKGVSFTSKFVIASTNSSNIIVPTVSDSDAIRRRFYMDCDIEVTDSYKTDLGRLDAGRAAKLCSENNTANFKRCSPLVCGKAIQLRDRKSKVRYSVDTVVSELIREYNNRSAIGNTIEALFQGPPKFRPIRISLEEKPAPDAISDLLASVDSEEVRQYCRDQGWIIPETPTNVERHLNRAVLVXQSIATVVAVVSLVYVIYKLFAGFQGAYSGAPKQILKKPVLRTATVQGPSLDFALSLLRRNIRQVQTDQGHFTMLGVRDRLAVLPRHSQPGKTIWVEHKLVNILDAVELVDEQGVNLELTLITLDTNEKFRDITKFIPESISAASDATLVINTEHMPSMFVPVGDVVQYGFLNLSGKPTHRTMMYNFPTKAGQCGGVVTSVGKVIGIHIGGNGRQGFCAGLKRSYFASEQGEIQWVKPNKETGRLNINGPTRTKLEPSVFHDVFEGNKEPAVLHSKDPRLEVDFEQALFSKYVGNTLYEPDEYIKEAALHYANQLKQLDIDTSQMSMEEACYGTENLEAIDLHTSAGYPYSALGIKKRDILDSTTRDVSKMKFYMDKYGLDLPYSTYVKDELRSIDKIKKGKSRLIEASSLNDSVYLRMTFGHLYETFHANPGTVTGSAVGCNPDTFWSKLPILLPGSLFAFDYSGYDASLSPVWFRALELVLREIGYSEEAVSLVEGINHTHHVYRNKTYCVLGGMPSGCSGTSIFNSMINNIIIRALLIKTFKGIDLDELNMVAYGDDVLASYPFPIDCLELARTGKEYGLTMTPADKSPCFNEVNWDNATFLKRGFLPDEQFPFLIHPTMPMKEIHESIRWTKDARNTQDHVRSLCLLAWHNGKQEYEKFVSAIRSVPVGKALAIPNYENLRRNWLELF

Loki would have you believe that these instructions, carried by the specific arrangement of nucleotides in the dna molecule randomly occurred and just happen to puke out a fully functional protein with all the correct bends to form its extremely complex structure.

We've all seen this from you numerous times, and we all know that it is just a distorted misrepresentation of my position.

Not only that, but this protein interacts with 1000's of other proteins inside an organism to produce just one of many functions required for that orgainism's survival.

Apparently only "the information dna carries is independent of the mere chemistry of the molecule."

Do you possibly have any grasp the odds against producing this protein much less producing this and the other proteins with as much or more complexity to work in concert together with each other inside a complex organism. Only a fool would believe that time was the "magic" that made this happen all by itself.

But just keep telling yourself it wasn't designed... it wasn't designed.

Why? Why should I do that? What purpose would telling myself that serve?

 

[Hollie]

But just keep telling yourself it wasn't designed... it wasn't designed.

Here we have the entirety of the creationist rebuttal to science and knowledge: "its complicated, therefore we knew with certainty that the gods did it".

It's the classical argument from ignorance that defines the creationist agenda.